Categories
Linux Mastering Development

sort fasta file based on its alphanumeric ids

Ipunensis_00386 Yfr1 GCGGAGACGAAAGTTTCCGTTCACTCCTCACACCACACTCCGCCCAAATCATTGATTTGG GCGGTT Ipunensis_00401 tRNA-Gly(gcc) GCGGGTATAGCTCAGTGGTAGAGCGTCACCTTGCCAAGGTGAATGTCGCGCGTTCGAATC GCGTTACCCGCT Ipunensis_00001 transposase IS4 family protein ATGCAGAAGTTTCAGGGCATCCACTGGGTCAACCTAGACGGGCAGCACCAGGTTAGCAAT CTCAGTGATGAGCGACGCTTAATCATCCACCTCTTGGGGCCACCTGTTGAGCGCTACTAC CATGCCCCTGGTTAA Ipunensis_00002 Photosystem I assembly protein Ycf3 ATGCGTCACCCCGCCAAGTTACTCGGGTTAGTCACTCTCACCAGTATGCTTACGCTGGCT Ipunensis_00003 Cell wall-associated protease ATGAAACGTTTTCTGACCAGTCTTTTGCTGACGGGCCTGCTTTGGCATAGTGGGGGCAGC GTTGGGGTTGGGAGAGGTGCGATCGCACAAACCCAGTCCACCCCAGACCTCTACTACACC Ipunensis_00004 Photosystem I assembly protein Ycf3 TTGACCTGCGGCCCGCAGCCCTACCTGCCCAACCTGACTCCAGAAATTCCCATGATCTAC CGCCTCTCGTCTCCCGGATTTTTGCTGGCGCTGCTGCTGCTATCTGCCGTCGATCCGGCA Ipunensis_00226 tRNA-Leu(gag) TGCGGATGTGGTGGAACTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTACGCCTTGC GAGTTCGAGTCTCGCCATCCGCAT Ipunensis_00045 tRNA-Ala(cgc) GGGGAATTAGCTCAGCTGGTAGAGCGCTGCGATCGCACCGCAGAGGTCAGGAGTTCGAAT CTCCTATTCTCCA Ipunensis_00357 glnA ATCGTTCATCTCTTCAAACTGTCAAAGCTACTTACAAAAGCTACAGACGCACCAAGAGAC GGAAGTAGGGGTCTGATCCCCCCGAAGGAACGCGCC Ipunensis_00403 tRNA-Gly(gcc) GCGGGTATAGCTCAGTGGTAGAGCGTCACCTTGCCAAGGTGAATGTCGCGCGTTCGAATC How can I […]