How to replace the specific ‘NA’ value (not all ‘NA’) to the specific numerical value in R data frame?

I have a large data frame which has more than 500 rows and 40 columns like; dataframe <- data.frame(ID=c(“ID1″,”ID2″,”ID3″,”…”), column1=c(1,NA,0,1), column2=c(1,0,0,1),column3=c(1,NA,NA,NA),… = c (1,0,1,1)) Now in column 3, there are three ‘NA’ values, and I want to replace column3 of ID2 to numerical value ‘1’. Please tell me the good way to do so.

Details

Previous integration test consumes current test queue message

So I am trying to use some queues in my project(rabbitmq). I decided to create simple publisher/receiver integration tests. So I ve made simple sender @Component public class QueueSender { … public void sendMessage(@RequestParam String message) { rabbitTemplate.convertAndSend(queue, message); } } and corresponding test @SpringBootTest(classes = QueueSender.class, webEnvironment = SpringBootTest.WebEnvironment.NONE) @Import(RabbitAutoConfiguration.class) class QueueSenderTest { ……

Details

Update hidden field value in thread function, and get hidden field value from client-side JQuery

I have a thread function for inserting data from an Excel file to the database, whose data is then bound to an ASP.NET GridView I want to get the value of the variable from my function from client-side. Thanks. private void InsertToDb() { try { int successItems = 0; int columnsCount = int.Parse(Session[“ColumnsCount”].ToString()); int drpSelectedIndex…

Details

Custom action button into a custom column on WooCommerce admin orders list

First, I made a custom column. function add_example_column($columns) { $columns[‘EXAMPLE’] = ‘EXAMPLE’; return $columns; } add_filter( ‘manage_edit-shop_order_columns’, ‘add_example_column’ ); After, I made a new action. function example_action($actions) { $actions[‘example’] = array ( ‘url’ => ‘https://example.com?action=ups’, ‘name’ => __( ‘Some text’, ‘woocommerce’ ), ‘action’ => ‘example’ ); return $actions; } add_action( ‘woocommerce_admin_order_actions’, ‘example_action’, 10, 1 );…

Details

Find files having more than one occurrence of a pattern on the same line

I have a file in fasta format as in example below. I would like to extract entries from that file when sequence: ‘CGTACG’ occurs more than once. >seq1 AAATTCCGTACGGGCCTCT >seq2 TGGAATCACAGCGGCGTACGCAGCGGCGGCTGCGGCCGTACGGCG >seq3 AATGCCAAACGTACGAACAT In the example the output would be (as the sequence ‘CGTACG’ occurs twice): >seq2 TGGAATCACAGCGGCGTACGCAGCGGCGGCTGCGGCCGTACGGCG

Details

Using C++11 with move semantics – without the standard library (and with Boost.smart_ptr)

I’m working on embedded projects, using Zephyr RTOS with ARM embedded microcontrollers like STM32 Nucleo series (Cortex M4/0). Recently, due to significant C++ support improvements in the recent versions of Zephyr, I’m considering to move from C development to modern C++. By default, Zephyr includes C standard library, but not Cpp’s STD. Zephyr actually added…

Details