Query gets truncated while executing in sqlcmd in shell script

I am trying to execute a select statement from linux via sqlcmd, the query length is of 5100 characters. When I print the result using echo the entire query is being displayed, but sqlcmd execution is truncating the query and executing Query=”select ‘”‘+cast(CandidateID as nvarchar(max))+'”‘,'”‘+cast(FirstName as nvarchar(max))+'”‘,<100+ columns> from CandidatePersonalDetail” echo $Query echo `/opt/mssql-tools/bin/sqlcmd -S…

Details

Docker nginx-proxy hangs on startup

Docker version 19.03.5, build 633a0ea838 Linux xxx 5.0.0-37-generic #40~18.04.1-Ubuntu SMP Thu Nov 14 12:06:39 UTC 2019 x86_64 x86_64 x86_64 GNU/Linux I’m trying to setup an Nginx Proxy with Docker for a multiple wordpress instances on the same machine following this guide: pattonwebz multiple wordpress containers The resulting Dockerfile of the nginx-proxy containers is this: version:…

Details

How can I copy lines from multiple files into one file and name lines as the originated filename

My question is: I have 200 files in fata format. Such as: /User/Bin/bin.0.fa /User/Bin/bin.1.fa … /User/Bin/bin.200.fa Each .fa file contains a contig name ID and nucleotide characters delimited as: In /User/Bin/bin.0.fa >c_000000000001 CGACATTTTCCAACTTATTTTTTCCTGTAGTAAAAATTATTTACATACAAAAAAGGAGCTGTTCACTAATTATTTAGTGC >c_000000000002 TACAACTCCTTTTTACTATTCTTCTGAATTTGATTTTTCATCCATTTGTTTTTGAGCTTCTTGAACTAATTTATCAAGACTATTATCTTCTACAACTTCATTTTCTTGTCTATCTAATTCATCTGTTAATGTTAATTGCTGATCTTTATCTTCTACATCT CTACCTGAAATTTTAGCTATAGCTACAATCTTTTCTTCATCAGAAGTTCTCATTAATCTAACTCCCATTGTAGCTCTAC >c_000000000003 AGTTACAGATACATCTGATACATTAATTCTTATAGCAACACCACTTGTATTTATAAGCATTAATTCATCTTCAGATTTACATACTGTTGCACCAACAACTTTACCAGTCTTTTCACTGATTTTGTATGTTATTAAACCAACTCCACCTCTATTTTGTCTC … In /User/Bin/bin.1.fa >c_000000000004 GGATCATCGCTTGTACATCCCAAACCAAAAAAGAATACTGCACTTACAATCAGTTGGATTTGAAACGCGATTTTCATTTTTGGTATATGTTTAAGATTAGCACTTTGTTTCATTGCTTTTGGCTATGAACGATGTTTACGGGGGTGTA >c_000000000005 GAAAGAAGCGTATTGGTCGGTATAAATACCGCTCAACTAAACGAGCACAAAGCTACCGAAAATTTGGATGAATTGGCTTTTCTGGCCCAAACGGCTGGAGC >c_000000000006 CGGCACTTATTTGCCCCAGCCCATTTTGGGGGTAGAAATACCCAAGAGCAAGGGAAAGGTTCGCCTTCTGGGTGTGCCTACCGTGGTTGACCGTATGTTGCAAC … … In /User/Bin/bin.200.fa >c_000000020120 CTCTGCAACTGGATCCCGAAAAGATCCGCAAAGAAAGCGAACCCAAAGAAAAAGTCGATCTGGAGAGCACCGTCGCCCGCAGTCTGGCCACCCT >c_000000020121 CATCAATCATCTCAAATACTACCGCAACGCAGATTATTCCCAGTGCAATAACAAAACCGACTCCCGCCTCTTTTGTCTGGCCGTA…

Details

PHPUnit Testing and woocommerce Constant

I tried to perform a test on the WC_VERSION constant. here is my function : public function check_wc_version() { return defined(‘WC_VERSION’); } and my test function : public function test_check_wc_version() { $this->assertTrue($result); } woocommerce is well activated. and I even added an entry in tests/bootstrap.php: $GLOBALS[ ‘wp_tests_options’ ] = array( ‘active_plugins’ => array( ‘woocommerce/woocommerce.php’ )…

Details

FFMpeg trim video based on frame numbers (have code but audio isn’t trimming)

I’m trying to trim and re-encode my videos based on frame numbers. The following works great for my videos -vf select=”between(n\,$start_frame\,$end_frame),setpts=PTS-STARTPTS” however this doesn’t trim the audio since its vf filter. Any ideas how I can trim the audio perfectly with my video? P.S. Tried -af aselect=”…” but didn’t work

Details