Categories
Ask Chemistry

Creating 1L of 1000 ppb stock solution of Pb2+

I’m testing on samples that require a concentration of 1000 ppb (or 1 mg/L) of Pb 2+. My first thought was to simply dissolve 1 mg of Lead nitrate in 1 L of deionized distilled water to create 1 L of stock solution at the desired 1000 ppb (1 mg/L) concentration. Is the process as […]

Categories
Ask Chemistry

Why does the thienobenzodiazepine ring in Olanzapine have seniority over the piperazine ring?

This is really really bugging me. I am no means an expert in IUPAC naming , but I just feel like I need to know. Both of them have amines, so it can’t be the fact That one of them has an amine and one of them doesn’t. Is it the fact that the thienobenzodiazepine […]

Categories
Apple User Help

How to plot year versus month-day data

I’m very new to R so please bear with me. I have included a google drive link to the dataset (csv file) I need help with: https://drive.google.com/file/d/1EJvUwgVQMsv-ztlUftavOaEPU_6M9FYl/view?usp=sharing I am hoping to plot year along the x-axis and months and days along the y axis so that it looks something like the image below, where I […]

Categories
Apple User Help

macOS Catalina – External Hard Drive not sleeping when lid closed and laptop sleeping

So I’m trying to figure out why my external hard drive remains on (light displaying) when the laptop is sleeping. Details: macos 10.15.3 macbook pro energy saver disabled > Enable Power Nap while on battery power disabled in battery and power adapter enabled > Put hard disks to sleep when possible in battery and power […]

Categories
Ask Biology

Why don’t we bleed interstitial fluid?

Interstitial fluid is the fluid between cells in tissues – forming the medium between cells and capillaries. From what I gather, the typical human has 5L of blood and 11L of interstitial fluid. This raises an interesting question. If I get cut, why do I not bleed interstitial fluid? When humans are cut, generally their […]

Categories
Ask Chemistry

Basic Water Dissolving Salt Questions

I have a basic question about how water dissolves salt. In the Khan Academy explanation, it says that the H and Cl atoms attract each other while the O and Na atoms attract each other. My question: Does this weaken the bond between Na and Cl within a single NaCl molecule? Or does it weaken […]

Categories
Apple User Help

How to plot year versus month-day data

I’m very new to R so please bear with me. I have included a google drive link to the dataset (csv file) I need help with: https://drive.google.com/file/d/1EJvUwgVQMsv-ztlUftavOaEPU_6M9FYl/view?usp=sharing I am hoping to plot year along the x-axis and months and days along the y axis so that it looks something like the image below, where I […]

Categories
Apple User Help

Executing bash file with Error bin/bash: bad interpreter: No such file or directory

I am very new to bash and try writing the first script named hello_world in the path of /Users/me/Study/Linux with the content written by vim: #! bin/bash echo Hello World However, the error occurs when executed: -bash: /Users/me/Study/Linux/hello_world: bin/bash: bad interpreter: No such file or directory I have read many questions on the issue but […]

Categories
Ask Biology

Why does the genome of an RNA virus like coronavirus include thymine?

The United States department of health published a reference genome of the sars coronavirus from Wuhan, below is an extract of the first 20 bases: attaaaggtttataccttcc Considering that coronaviruses are a type of RNA virus, and that these are composed of Adenine, Citosine, Guanine and Uracil, I was surprised to see t symbols in the […]

Categories
Apple User Help

How can I get 2560X1080 resolution on my LG 29UM58-P monitor, connected to my 13″ MacBook Pro?

I have a MacBook Pro (Retina, 13″-inch, Early 2013) with 8Gb RAM and Intel HD Graphics 4000 I also have a 19″ Polyview 16:9 monitor connected via Thunderbolt to VGA adaptor, which displays its native resolution of 1440×900. I recently purchased an LG 29UM58-P ultra wide monitor, which has a native selection of 2560×1080 at […]