Categories
Ask Biology

Why don’t we bleed interstitial fluid?

Interstitial fluid is the fluid between cells in tissues – forming the medium between cells and capillaries. From what I gather, the typical human has 5L of blood and 11L of interstitial fluid. This raises an interesting question. If I get cut, why do I not bleed interstitial fluid? When humans are cut, generally their […]

Categories
Ask Biology

Why does the genome of an RNA virus like coronavirus include thymine?

The United States department of health published a reference genome of the sars coronavirus from Wuhan, below is an extract of the first 20 bases: attaaaggtttataccttcc Considering that coronaviruses are a type of RNA virus, and that these are composed of Adenine, Citosine, Guanine and Uracil, I was surprised to see t symbols in the […]

Categories
Ask Biology

Are there examples with more beautiful female animal than male ones?

In the animal kingdom (apart from homo-sapiens) are there examples with more beautiful female animal than male ones? Also, why is that applicable ( or not ) to human beings (are there any existing theories)?

Categories
Ask Biology

What’s the term for interspecies adoption?

I was reading up some time ago and came across a fancy, scientific term for cross-species adoption, but forgot and can’t find it again. :\

Categories
Ask Biology

SARS-CoV-2 proteome: is the SPIKE protein not an issue for a hospitalized patient?

I am performing molecular docking of ligands using the modeled proteome of SARS-Cov-2. My question is, after a patient is hospitalized, is the SPIKE protein not really an issue anymore, since its role for binding with ACE2 has already been carried out? Or, is SPIKE an ongoing issue that is not only an early event […]

Categories
Ask Biology

How to develop COVID-19 pneumonia vulnerability precognition test for all? [closed]

re. How to develop COVID-19 pneumonia vulnerability precognition test for all ? Hi, I have completed Infection Prevention and Control (IPC) for Novel Coronavirus (COVID-19) course by WHO and I have 3 teams of collaborators. We are working on procedures to predict development of COVID-19 pneumonia among non-infected patients, studying vulnerability to Anaphylactic Shock. I […]

Categories
Ask Biology

Unknown mite species in plant pots

does anybody know what kind of mite this is? Actually it is living in my plant pots.

Categories
Ask Biology

Unknown mite species in plant pots

does anybody know what kind of mite this is? Actually it is living in my plant pots.

Categories
Ask Biology

Unknown mite species in plant pots

does anybody know what kind of mite this is? Actually it is living in my plant pots.

Categories
Ask Biology

Are there COVID-19 citizen science projects to compare habits and outcomes?

I’ve seen some “citizen science” projects for coronavirus that are not really collaborations, but simply requests for processing time. Are there any “real” projects where people who have gotten their diagnoses could go, chat with one another, volunteer to publicly disclose their virus status, test results such as O2 perfusion, and daily self-rating of symptoms, […]